si:ch211-287b5.1

Ensembl ID:
ENSDARG00000002880
ZFIN ID:
ZDB-GENE-060503-41
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LUH6]
Human Orthologue:
CCDC132
Human Description:
coiled-coil domain containing 132 [Source:HGNC Symbol;Acc:25956]
Mouse Orthologue:
Ccdc132
Mouse Description:
coiled-coil domain containing 132 Gene [Source:MGI Symbol;Acc:MGI:1920538]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10581 Nonsense Available for shipment Available now
sa32255 Essential Splice Site Available for shipment Available now
sa23579 Nonsense Available for shipment Available now
sa43334 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29252 Nonsense Mutation detected in F1 DNA During 2017
sa3030 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa10581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017917 Nonsense 43 314 3 12
ENSDART00000110699 Nonsense 43 965 3 28
Genomic Location (Zv9):
Chromosome 19 (position 41356264)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40808802
KASP Assay ID:
2261-3613.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCATTTYTTTTGCTTTTCACACAGGAGGAGCTGAGGGAGCTGAGAGAG[C/T]AGCCCAMSGATCCACAGGCAGAAMAAGAAATCATTGACAGCATAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017917   None 314 None 12
ENSDART00000110699 Essential Splice Site 544 965 18 28
Genomic Location (Zv9):
Chromosome 19 (position 41512606)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40964961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAGACAACAAAGAAGAGGAGACTGAGGACGTCCTGGCTTCTAATGGGG[T/C]ATATAGTAGTTTGAATGATGGTCATGTTATGTACAGTTTTATATACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017917   None 314 None 12
ENSDART00000110699 Nonsense 646 965 21 28
Genomic Location (Zv9):
Chromosome 19 (position 41525869)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40978224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCATCGCCTTTGATGTCATCCACTGTGTGTCTCAGCTCTTTGATTA[T/G]TACCTGTATGCCGTCTACACCTTCTTCGGCCGCAATGACATGGTATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017917   None 314 None 12
ENSDART00000110699 Essential Splice Site 687 965 22 28
Genomic Location (Zv9):
Chromosome 19 (position 41548586)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41000941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATTGAGGACCACTCTCAGCCGAATCCAGGAGAGCCTAATAGACATG[G/A]TGAGTAAAACATGACTCGTTTAATGCACTCTTTCAGTTTTCCCCCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017917   None 314 None 12
ENSDART00000110699 Nonsense 776 965 25 28

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 41613297)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41065551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACATTTTCCGCTGCTGTTTTCTCTACAGACTGTATCAACGGCCAGC[G/T]AGCTCCGCAAGCCCATTTACTGGATCGTGGCAGCCAAAGCCATAGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3030
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017917   None 314 None 12
ENSDART00000110699 Nonsense 950 965 28 28
ENSDART00000017917   None 314 None 12
ENSDART00000110699 Nonsense 950 965 28 28

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 41645988)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41098242
KASP Assay ID:
554-3435.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTAACCTGGTCAACGTCTGCCTCGGGTCCCACATCAACAAGAAAGCA[C/T]GACAGAAACTCCTCGCAGCCATTGATGACATTGACCGGCCCAAAAGATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link