si:dkey-217m5.1

Ensembl ID:
ENSDARG00000002877
ZFIN ID:
ZDB-GENE-030131-9536
Description:
ralBP1-associated Eps domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001038521]
Human Orthologue:
REPS1
Human Description:
RALBP1 associated Eps domain containing 1 [Source:HGNC Symbol;Acc:15578]
Mouse Orthologue:
Reps1
Mouse Description:
RalBP1 associated Eps domain containing protein Gene [Source:MGI Symbol;Acc:MGI:1196373]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23780 Essential Splice Site Available for shipment Available now
sa23781 Nonsense Available for shipment Available now
sa776 Nonsense F2 line generated During 2017
sa8763 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019744 Essential Splice Site 93 791 2 20
ENSDART00000132132 Essential Splice Site 93 790 2 20
Genomic Location (Zv9):
Chromosome 20 (position 39253774)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39326186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTGGCCCAGTCTGGACTGCCCCTGCGCCTCGAGAGCCTGAACACTGG[T/C]GGGTAGCATTAGCTTCTTAAAAACCTAATAACTGTTTCTTCAGCAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019744 Nonsense 268 791 6 20
ENSDART00000132132 Nonsense 268 790 6 20
Genomic Location (Zv9):
Chromosome 20 (position 39262298)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39334710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGTACGGACTGTGCCATCTGCAATGACCACAAATGAAATCCAAAGA[C/T]AGACCAGTGGTTACGACGACCCCTGGAAAATCACAGATGAGCAAAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa776
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019744 Nonsense 282 791 6 20
ENSDART00000132132 Nonsense 282 790 6 20
Genomic Location (Zv9):
Chromosome 20 (position 39262340)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39334752
KASP Assay ID:
554-0681.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAAGACAGACCAGTGGTTACGACGACCCCTGGAAAATCACAGATGAG[C/T]AAAGACAGTATTACATAAACCAGTTCAAGACCATTCAAGCAGATCTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019744 Nonsense 677 791 17 20
ENSDART00000132132 Nonsense 676 790 17 20
Genomic Location (Zv9):
Chromosome 20 (position 39279722)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39352134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTGCCGGGACGATGAGAACAGCAAAGAACGACGTTCAAGCCGAAGAA[C/T]GAAATGYAACCACTGTCAACTCTGTAARGCAGTCTCTRTGCACCACAGKT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link