si:ch211-198b3.2

Ensembl ID:
ENSDARG00000002847
ZFIN ID:
ZDB-GENE-041210-332
Description:
Novel protein similar to vertebrate fibronectin type III domain containing 1 (FNDC1) [Source:UniProt
Human Orthologue:
FNDC1
Human Description:
fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:21184]
Mouse Orthologues:
CT485609.1, Fndc1
Mouse Description:
fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915905]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25140 Nonsense Mutation detected in F1 DNA During 2017
sa23734 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Nonsense 599 1645 11 22
ENSDART00000136039   None 110 None 4
ENSDART00000139643   None 335 None 8
Genomic Location (Zv9):
Chromosome 20 (position 31063827)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31135040
KASP Assay ID:
554-7520.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAATCAAAACCCAGCAATTCTGACATTGTCCCTAAAACATCCGAGGAT[A/T]AACGTCCTCCTTGGACCCCTCGTACATCCTCAATTGTTGATATTAGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014163 Nonsense 830 1645 11 22
ENSDART00000136039   None 110 None 4
ENSDART00000139643   None 335 None 8
Genomic Location (Zv9):
Chromosome 20 (position 31063134)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31134347
KASP Assay ID:
2261-4505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATTCCACTTCCCATTCTTCTTCAAGGACTAACCCTTCTACAACAGGA[C/T]GAAGTTCATCCTTTTCGTTACCAAACCGAAATTCTAGAATAGTTACAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link