col4a4

Ensembl ID:
ENSDARG00000002831
ZFIN ID:
ZDB-GENE-101001-1
Description:
Type IV collagen alpha 4 chain [Source:UniProtKB/TrEMBL;Acc:Q4TZW9]
Human Orthologue:
COL4A4
Human Description:
collagen, type IV, alpha 4 [Source:HGNC Symbol;Acc:2206]
Mouse Orthologue:
Col4a4
Mouse Description:
collagen, type IV, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:104687]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7771 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22697 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2802 Nonsense F2 line generated During 2014
sa6390 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22696 Nonsense Mutation detected in F1 DNA During 2014
sa18383 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061186 Essential Splice Site 468 1670 21 47
Genomic Location:
Chromosome 15 (position 35260325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGGAGAAAGAGGGATTGTCGGATATAAAGGTGTCCAGGGGAGAAAAG[G/A]TRAGGTTTCATACCTAAATATATGTTTTTATGATTCTTGTYTTAAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061186 Essential Splice Site 886 1670 30 47
Genomic Location:
Chromosome 15 (position 35244370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGAGTCAACGGTGACGGTGGAAATCCTGGATATCCTGGACCAAAGGG[T/C]AAAGAGTCTTTCGAAGAGAGCTTAATGTGTTTTAGGAAGTTAATTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2802
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061186 Nonsense 1433 1670 45 47
Genomic Location:
Chromosome 15 (position 35228084)
KASP Assay ID:
554-2947.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACCATCTTATCSTTTTCTATACCAGGACCTCCGGGACCAGATGGTGAT[C/T]GAGGTCCCCCTGGAAGAAATGAGACACTTTCTACAGGCTTTCTTYTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061186 Essential Splice Site 1488 1670 45 47
Genomic Location:
Chromosome 15 (position 35227917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTGCTTTACCTGGAGGGTCAGGAGAGAGCACACACACAAGATCTGGG[T/A]ATGTGGCTAAAGCTCATAYTGACATTTAAAAGTGACTATGATTACTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061186 Nonsense 1577 1670 46 47
Genomic Location:
Chromosome 15 (position 35226407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACCGTCTTGACCCAGTGTGTCCACCCAAATGGAGGAGCCTCTGGACC[G/T]GATTTTCATTCATGATGGTAAGGAAAAAGCTCAGCTCCGTTTAAAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061186 Nonsense 1583 1670 47 47
Genomic Location:
Chromosome 15 (position 35224946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAATTTTGATATTAAGCANACTTTAAATMACCTGTCTGTGTTCCAGTA[T/A]ACGGGGTCAGGGGATGAAGGCGGTGGACAGTCTCTGACATCAACAGGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o7gh01t1