trmt2a

Ensembl ID:
ENSDARG00000002830
ZFIN ID:
ZDB-GENE-030131-6876
Description:
tRNA (uracil-5-)-methyltransferase homolog A [Source:RefSeq peptide;Acc:NP_956223]
Human Orthologue:
TRMT2A
Human Description:
TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:24974]
Mouse Orthologue:
Trmt2a
Mouse Description:
TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:96270]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1336 Nonsense Available for shipment Available now
sa20409 Nonsense Mutation detected in F1 DNA During 2014
sa6055 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046384 Nonsense 171 619 2 12

The following transcripts of ENSDARG00000002830 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26210962)
KASP Assay ID:
554-1250.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGAGGAAACAGGAGGAGGAGGCGGACAGCGGGCAACCTGGTGCCAAG[C/T]GAAATACAGGGAGCCAGGAGGCAGAAAAGGAGGAGGAAGAGCCTCCCAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046384 Nonsense 205 619 2 12

The following transcripts of ENSDARG00000002830 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26210860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGATTGCCAATGCCGTGACCCCATTGTGGAAAGTGCCTTATGAAGAA[C/T]AGCTGATGATGAAAGAGAAAGAAGTCGAAGGTGTTCTCCAAAAACTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046384 Essential Splice Site 222 619 3 12

The following transcripts of ENSDARG00000002830 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26210500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGNNNNNNNNNNNNNNNNATCTTTTAACTATCTTCCATATTTGTTTTC[A/T]GAGAAATTGGCAACAACAACAAAGCCATGCTTCCGTGGTTGTTCGTCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g79i77sd