cep57l1

Ensembl ID:
ENSDARG00000002826
ZFIN ID:
ZDB-GENE-040808-27
Description:
centrosomal protein 57-like 1 [Source:RefSeq peptide;Acc:NP_001003769]
Human Orthologue:
CEP57L1
Human Description:
centrosomal protein 57kDa-like 1 [Source:HGNC Symbol;Acc:21561]
Mouse Orthologue:
2410017P07Rik
Mouse Description:
RIKEN cDNA 2410017P07 gene Gene [Source:MGI Symbol;Acc:MGI:1915511]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12507 Nonsense Available for shipment Available now
sa8909 Nonsense Mutation detected in F1 DNA During 2014
sa8771 Nonsense Mutation detected in F1 DNA During 2014
sa23740 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048537 Nonsense 17 494 2 11
Genomic Location:
Chromosome 20 (position 32187208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTTTTKTGAATTACAGAGTTTTAATCTAGACTCCCCATCTAAA[C/T]AGAGTTATGTTGGCAGTTTTTATCAGCCACCAGAGAAAATGYCAAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048537 Nonsense 145 494 4 11
ENSDART00000048537 Nonsense 145 494 4 11
Genomic Location:
Chromosome 20 (position 32185614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTTCTAAGCTTCACTCAGCAGAAAYGCGCTGCTCTCTCCTGGAAAAA[C/T]AGCTCAACTWCATGAAGAGAATGGTGGAGTGTGCAGAAAAAGACACARTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048537 Nonsense 145 494 4 11
ENSDART00000048537 Nonsense 145 494 4 11
Genomic Location:
Chromosome 20 (position 32185614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTTCTAAGCTTCACTCAGCAGAAAYGCGCTGCTCTCTCCTGGAAAAA[C/T]AGCTCAACTWCATGAAGAGAATGGTGGAGTGTGCAGAAAAAGACACARTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048537 Nonsense 195 494 5 11
Genomic Location:
Chromosome 20 (position 32185325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAAATTCAGGCACAGCTCAATAAGCTTGAAAGACTGGAAAAGGAGTA[T/A]CTCAGACTCACCAATACACAGTCTGTGGCTGAGGTATACATATAGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/92psu779