rasgrf2

Ensembl ID:
ENSDARG00000002816
ZFIN ID:
ZDB-GENE-060504-1
Description:
Ras-specific guanine nucleotide-releasing factor 2 [Source:UniProtKB/Swiss-Prot;Acc:A2CEA7]
Human Orthologue:
RASGRF2
Human Description:
Ras protein-specific guanine nucleotide-releasing factor 2 [Source:HGNC Symbol;Acc:9876]
Mouse Orthologue:
Rasgrf2
Mouse Description:
RAS protein-specific guanine nucleotide-releasing factor 2 Gene [Source:MGI Symbol;Acc:MGI:109137]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20530 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1038 Nonsense F2 line generated During 2014
sa14369 Essential Splice Site Available for shipment Available now
sa3509 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10502 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Essential Splice Site 92 1244 1 27
Genomic Location:
Chromosome 5 (position 53315849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCGCTCAAGGTGTCCACTGTTGGCAAAGACGCACTTGACAAGCTGG[T/C]GAGTTCAGCGCTACTAACACACCTGTACAAATTGTGAGGGGTTTTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1038
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Nonsense 163 1244 3 27
Genomic Location:
Chromosome 5 (position 53373301)
KASP Assay ID:
554-0941.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGCAAATCGTGGAGACGGAGAAAGTGGCAGCAAACCAGCTCCGCACA[C/T]AACTGGAGGACCAAGACACTGAGATTGAGAGGCTTAAAGCTGAGGTAYGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Essential Splice Site 207 1244 4 27
Genomic Location:
Chromosome 5 (position 53376160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGTATTTCARGAAGAGGAAGATCCTGWTATWAAAAAAATTAAWAAGG[T/A]AAAAATAAACAACCTCCTGAGGTTATTCTGCAYGATCTCGATCATCATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Essential Splice Site 536 1244 12 27
Genomic Location:
Chromosome 5 (position 53395134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATCACAACATGCTCAAGTGTAAACTTCTGTTGTTTTTTTGTGTTCAC[A/G]GCTAAGAATTCAGGGCAGGTGTTCGGTCACCTTGACTTTAAGATTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083350 Nonsense 541 1244 12 27
Genomic Location:
Chromosome 5 (position 53395150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTGTAAACTTCTGTTGTTTTTTTGTGTTCACRGCTAAGAATTCAGGG[C/T]AGGTGTTCGGTCACCTTGACTTTAAGATTGTGGTGGAGCCTTCAGATGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o1s3xi6i