LOC558876

Ensembl ID:
ENSDARG00000002794
Human Orthologue:
RNF14
Human Description:
ring finger protein 14 [Source:HGNC Symbol;Acc:10058]
Mouse Orthologue:
Rnf14
Mouse Description:
ring finger protein 14 Gene [Source:MGI Symbol;Acc:MGI:1929668]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39027 Nonsense Mutation detected in F1 DNA During 2016
sa15812 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042580 Nonsense 217 436 3 6
Genomic Location:
Chromosome 15 (position 3660733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTTTTTCTGAGAACCTGGGCTCCAAATGTGTGCTCTTCAAAGAGTG[T/A]CAGCATGTGTACTGCAAGACCTGCGTGGAGGAGTACTTCAAGATCCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042580 Splice Site, Nonsense 257 436 3 6
Genomic Location:
Chromosome 15 (position 3660851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTCTYTCCTGTCCTGAGCCAGAGTGCACCTCCCTGGCTACTCCTGCA[C/T]AGGTACTTTTTTGTTTGTGTTTGTGCCRTTGTAAAACCTGGAGMMCCRCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link