atp1a1

Ensembl ID:
ENSDARG00000002791
ZFIN ID:
ZDB-GENE-001212-1
Description:
Na+/K+ -ATPase alpha 1 subunit [Source:RefSeq peptide;Acc:NP_571761]
Human Orthologue:
ATP1A1
Human Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide [Source:HGNC Symbol;Acc:799]
Mouse Orthologue:
Atp1a1
Mouse Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88105]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13646 Nonsense Available for shipment Available now
sa19398 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15598 Nonsense Available for shipment Available now
sa12184 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13646
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081047 Nonsense 114 1028 4 22

The following transcripts of ENSDARG00000002791 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1474627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTCTTTGGAGGATTCWCAACTCTCCTGTGGATTGGAGCCATCCTTTG[T/A]TTTCTTGCCTACGGCATCCTGGCGGCCTCTGAGGAGGARCCTGCCAATRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081047 Essential Splice Site 344 1028 8 22

The following transcripts of ENSDARG00000002791 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1475668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTATCATTGTTGCGAATGTACCAGAGGGTCTCTTGGCTACTGTAACT[G/A]TAAGTGTCAGAGGAATTGCTACAGATTTAGTTAAATTTAGTTCTACACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081047 Nonsense 569 1028 12 22

The following transcripts of ENSDARG00000002791 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1478569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MAACRTGTTGTTTCTCCACAGGATTCTGCCACTTCAATCTTCCCGATGAA[C/T]AGTTTCCTGAGGACTTCCAGTTCGATACTGAAGAAGTGAACTTCCCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081047 Essential Splice Site 821 1028 16 22

The following transcripts of ENSDARG00000002791 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1480295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTTTGGGCACCGTCACCATTCKCTGTATTGATCTGGGTACCGACATG[G/T]TRAGCACTGCATTTRATTGGTTCTATTTAATAGYTGGTTGGTGAGGTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zdo12bk4