ap2m1a

Ensembl ID:
ENSDARG00000002790
ZFIN ID:
ZDB-GENE-030131-9784
Description:
AP-2 complex subunit mu-1-A [Source:UniProtKB/Swiss-Prot;Acc:Q6NWK2]
Human Orthologue:
AP2M1
Human Description:
adaptor-related protein complex 2, mu 1 subunit [Source:HGNC Symbol;Acc:564]
Mouse Orthologue:
Ap2m1
Mouse Description:
adaptor protein complex AP-2, mu1 Gene [Source:MGI Symbol;Acc:MGI:1298405]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13901 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012442 Nonsense 296 436 8 11
ENSDART00000046587 Nonsense 296 436 9 12
ENSDART00000138472 None None 221 None 5
ENSDART00000139499 None None 113 None 4

The following transcripts of ENSDARG00000002790 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 9585862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCACTAAGRACATAATTCTGCCCTTCCGGGTCATTCCACTGGTTCGA[G/T]AGGTTGGACGCACAAAGCTGGAGGTCAAAGTTGTCATCAAATCTAACTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6rwpczwo