gro2

Ensembl ID:
ENSDARG00000002787
ZFIN ID:
ZDB-GENE-990415-86
Description:
Protein groucho-2 [Source:UniProtKB/Swiss-Prot;Acc:O13166]
Human Orthologue:
TLE3
Human Description:
transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) [Source:HGNC Symbol;Acc:11839]
Mouse Orthologue:
Tle3
Mouse Description:
transducin-like enhancer of split 3, homolog of Drosophila E(spl) Gene [Source:MGI Symbol;Acc:MGI:10

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9860 Nonsense Available for shipment Available now
sa9885 Nonsense Available for shipment Available now
sa23286 Nonsense Mutation detected in F1 DNA During 2014
sa18545 Nonsense Available for shipment Available now
sa4750 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16926 Essential Splice Site Available for shipment Available now
sa14607 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025018 Nonsense 40 776 2 20
ENSDART00000045679 Nonsense 40 776 3 21
ENSDART00000100632 Nonsense 40 759 2 19
ENSDART00000100633 Nonsense 40 762 2 20
ENSDART00000025018 Nonsense 40 776 2 20
ENSDART00000045679 Nonsense 40 776 3 21
ENSDART00000100632 Nonsense 40 759 2 19
ENSDART00000100633 Nonsense 40 762 2 20
Genomic Location:
Chromosome 18 (position 20008327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCCTGTGACAGGATCAAAGACGAATTTCAGTTCCTGCAAGCCCAATA[T/G]CACAGGTAATAATTTAGAGTTATGTGGCYGTAAAGTAGCTTGTACAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025018 Nonsense 40 776 2 20
ENSDART00000045679 Nonsense 40 776 3 21
ENSDART00000100632 Nonsense 40 759 2 19
ENSDART00000100633 Nonsense 40 762 2 20
ENSDART00000025018 Nonsense 40 776 2 20
ENSDART00000045679 Nonsense 40 776 3 21
ENSDART00000100632 Nonsense 40 759 2 19
ENSDART00000100633 Nonsense 40 762 2 20
Genomic Location:
Chromosome 18 (position 20008327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCCTGTGACAGGATCAAAGACGAATTTCAGTTCCTGCAAGCCCAATA[T/G]CACAGGTAATAATTTAGAGTTATGTGGCYGTAAAGTAGCTTGTACAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025018 Nonsense 241 776 9 20
ENSDART00000045679 Nonsense 241 776 10 21
ENSDART00000100632 Nonsense 224 759 8 19
ENSDART00000100633 Nonsense 227 762 9 20
Genomic Location:
Chromosome 18 (position 20029329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACAGCCTGCGCACAACCAGTGAGAAGCACCGTGGCTCCTCCGATTA[C/A]AGCTTAGACTCCAAAAAACGCAAAGTGGAGGACAAGGACAGCATGAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025018 Nonsense 381 776 13 20
ENSDART00000045679 Nonsense 381 776 14 21
ENSDART00000100632 Nonsense 364 759 12 19
ENSDART00000100633 Nonsense 367 762 13 20
Genomic Location:
Chromosome 18 (position 20030879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGTGTCTATGTGTCTGCAGCCGCCCCTGCTCTGCGCACCCCTCTCACTTA[C/A]CCAACTCCCTTCGCCATGATGAGCCACCATGAGATGAATGGTTCTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025018 Essential Splice Site 425 776 13 20
ENSDART00000045679 Essential Splice Site 425 776 14 21
ENSDART00000100632 Essential Splice Site 408 759 12 19
ENSDART00000100633 Essential Splice Site 411 762 13 20
ENSDART00000025018 Essential Splice Site 425 776 13 20
ENSDART00000045679 Essential Splice Site 425 776 14 21
ENSDART00000100632 Essential Splice Site 408 759 12 19
ENSDART00000100633 Essential Splice Site 411 762 13 20
Genomic Location:
Chromosome 18 (position 20031013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCCTCAGATGAGCGCGGCTGCTGCTGCTGCCTACGGGCGCTCGCCCATGG[T/C]GAGTAATTGTGCGWTTGTGTTAAATAAGCACCTTAGTGAAAGAGCTGYTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025018 Essential Splice Site 425 776 13 20
ENSDART00000045679 Essential Splice Site 425 776 14 21
ENSDART00000100632 Essential Splice Site 408 759 12 19
ENSDART00000100633 Essential Splice Site 411 762 13 20
ENSDART00000025018 Essential Splice Site 425 776 13 20
ENSDART00000045679 Essential Splice Site 425 776 14 21
ENSDART00000100632 Essential Splice Site 408 759 12 19
ENSDART00000100633 Essential Splice Site 411 762 13 20
Genomic Location:
Chromosome 18 (position 20031013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCCTCAGATGAGCGCSGCTGCTGCTGCTGCCTACGGGCGCTCGCCCATGG[T/C]GAGTAATTGTGCGWTTKTGTTAAATAAGCACMTTAGTGRAAGAGCTGYTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025018 Essential Splice Site 665 776 17 20
ENSDART00000045679 Essential Splice Site 665 776 18 21
ENSDART00000100632 Essential Splice Site 648 759 16 19
ENSDART00000100633 Essential Splice Site 651 762 17 20
Genomic Location:
Chromosome 18 (position 20035446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCTCAGGGAGGGAAGGCAACTCCAACAGCACGACTTCACATCTCAG[G/A]TTAGAAGWTARAGCATGGATTTTTWAAATTTATGTTCCACMTTATTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4nsthn92