pdx1

Ensembl ID:
ENSDARG00000002779
ZFIN ID:
ZDB-GENE-990415-122
Description:
pancreas/duodenum homeobox protein 1 [Source:RefSeq peptide;Acc:NP_571518]
Human Orthologue:
PDX1
Human Description:
pancreatic and duodenal homeobox 1 [Source:HGNC Symbol;Acc:6107]
Mouse Orthologue:
Pdx1
Mouse Description:
pancreatic and duodenal homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:102851]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa280 Nonsense Confirmed mutation in F2 line During 2017
sa3263 Nonsense F2 line generated During 2017
sa12 Nonsense Available for shipment Available now
sa37883 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa280
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014696 Nonsense 37 246 1 2
ENSDART00000014696 Nonsense 37 246 1 2
Genomic Location (Zv9):
Chromosome 24 (position 22292343)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21539221
KASP Assay ID:
554-2912.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGACACCCCAACGAAGACTACAGCCAAAACCCTCCACCGTGTCTTTA[T/A]ATGAGACAGGCACATTCAGTATACGCCTCACCATTGGGCGCACAGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3263
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014696 Nonsense 37 246 1 2
ENSDART00000014696 Nonsense 37 246 1 2
Genomic Location (Zv9):
Chromosome 24 (position 22292343)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21539221
KASP Assay ID:
554-2912.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGACACCCCAACGAAGACTACAGCCAAAACCCTCCACCGTGTCTTTA[T/A]ATGAGACAGGCACATTCAGTATACGCCTCACCATTGGGCGCACAGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014696 Nonsense 208 246 2 2
ENSDART00000014696 Nonsense 208 246 2 2
Genomic Location (Zv9):
Chromosome 24 (position 22294255)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21541133
KASP Assay ID:
1198-0001.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGAAAAAAGAGGAGGACAAGAGGAGAGCCAGGGGAGTGGATCCCGAA[C/T]AGGACTCCTCCATCACGTCCGGGGATCTTAAGGATGAATCTTGCGTCGGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014696 Nonsense 208 246 2 2
ENSDART00000014696 Nonsense 208 246 2 2
Genomic Location (Zv9):
Chromosome 24 (position 22294255)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21541133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGAAAAAAGAGGAGGACAAGAGGAGAGCCAGGGGAGTGGATCCCGAA[C/T]AGGACTCCTCCATCACGTCCGGGGATCTTAAGGATGAATCTTGCGTCGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link