miox

Ensembl ID:
ENSDARG00000002764
ZFIN ID:
ZDB-GENE-050913-113
Description:
Inositol oxygenase [Source:UniProtKB/Swiss-Prot;Acc:Q4V8T0]
Human Orthologue:
MIOX
Human Description:
myo-inositol oxygenase [Source:HGNC Symbol;Acc:14522]
Mouse Orthologue:
Miox
Mouse Description:
myo-inositol oxygenase Gene [Source:MGI Symbol;Acc:MGI:1891725]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6497 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4738 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa6497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019831 Essential Splice Site 2 278 2 10
ENSDART00000140752 Essential Splice Site 7 283 2 10
Genomic Location:
Chromosome 18 (position 5828041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAATCTATTAGCCAGTTTTCTTACACATTCATGTATTTTTTTACTCAC[A/T]GGGTCCAGACCCCTCTTTGGCATATCGACCTGAATGTCATGAGAAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4738
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019831 Nonsense 108 278 5 10
ENSDART00000140752 Nonsense 113 283 5 10
Genomic Location:
Chromosome 18 (position 5822907)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTACTAAATTTAAAATCGTTTCTCTCATTTTCCTCTGTCTCTAGACTG[G/A]TTTCAGCTAGTTGGTCTGATCCATGATGTTGGAAAGGTCATGGCCTTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ab1p5l6l