gdf5

Ensembl ID:
ENSDARG00000002760
ZFIN ID:
ZDB-GENE-990415-39
Description:
Contact [Source:UniProtKB/TrEMBL;Acc:O42303]
Human Orthologue:
GDF5
Human Description:
growth differentiation factor 5 [Source:HGNC Symbol;Acc:4220]
Mouse Orthologue:
Gdf5
Mouse Description:
growth differentiation factor 5 Gene [Source:MGI Symbol;Acc:MGI:95688]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015051 Nonsense 222 474 2 2
Genomic Location:
Chromosome 6 (position 52591574)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGGAGAAGGAGGGTCTGCTGGGTGCGGAGCTGCGGATCCTCCGAAAG[A/T]AGCACATGGACTCTCGAAAAGCCACKTTCTCTGAGGGCATGGCAGTTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9lnfvm7g