phf20a

Ensembl ID:
ENSDARG00000002750
ZFIN ID:
ZDB-GENE-070912-270
Description:
Novel protein similar to vertebrate PHD finger protein 20 (PHF20) [Source:UniProtKB/TrEMBL;Acc:A8HAK
Human Orthologue:
PHF20
Human Description:
PHD finger protein 20 [Source:HGNC Symbol;Acc:16098]
Mouse Orthologue:
Phf20
Mouse Description:
PHD finger protein 20 Gene [Source:MGI Symbol;Acc:MGI:2444148]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31829 Nonsense Available for shipment Available now
sa12229 Nonsense Available for shipment Available now
sa27790 Nonsense Mutation detected in F1 DNA During 2017
sa1493 Nonsense Available for shipment Available now
sa21909 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018743 Nonsense 103 951 3 20
ENSDART00000123263 Nonsense 103 932 4 17
ENSDART00000126488 Nonsense 103 544 4 11
ENSDART00000127817   None 380 None 7
Genomic Location (Zv9):
Chromosome 11 (position 25982416)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24811241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATGTGAATGACAGAGTTCTTGCCAGTTGGTCCGACTGTCGATTTTA[T/A]CCGGCAAAAGTTCTGGCTGTCAATAAAGATGGTAATAAAATTAAAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018743 Nonsense 121 951 4 20
ENSDART00000123263 Nonsense 121 932 5 17
ENSDART00000126488 Nonsense 121 544 5 11
ENSDART00000127817   None 380 None 7
Genomic Location (Zv9):
Chromosome 11 (position 25983722)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24812547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAYTCTAATGACAAAATGATCYTCCAGCATCYTACACAGTAAAGTTCTA[C/A]GATGGTGTCGTCCAGACAGTCAARGGAATCCATGTGAAGCCCTTCACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018743 Nonsense 155 951 5 20
ENSDART00000123263 Nonsense 155 932 6 17
ENSDART00000126488 Nonsense 155 544 6 11
ENSDART00000127817   None 380 None 7
Genomic Location (Zv9):
Chromosome 11 (position 25983913)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24812738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGACGAAAGAAACTGAGTGACCAGAATGGAGAGAAGCCAGTGATA[C/T]AACAGGCAGAAAAGGAAATCCAGGAGAATGAAGCCAATGGTGATAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018743 Nonsense 337 951 8 20
ENSDART00000123263 Nonsense 341 932 8 17
ENSDART00000126488 Nonsense 341 544 8 11
ENSDART00000127817   None 380 None 7
Genomic Location (Zv9):
Chromosome 11 (position 25986841)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24815666
KASP Assay ID:
554-1418.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAYAATCAGCAAACTCAAGGAAAAGAACCAGACTCCTTACATCTTACA[C/T]AACCGTCCAATGGCACATCAGCATCTCAGGCTCAGTGCCAATCAGAAACC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018743 Nonsense 719 951 15 20
ENSDART00000123263 Nonsense 724 932 15 17
ENSDART00000126488   None 544 None 11
ENSDART00000127817 Nonsense 173 380 4 7
Genomic Location (Zv9):
Chromosome 11 (position 25992451)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24821276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACATCTTTTTTTTCTGCAGGAACCAGACTCATCCAGATCTTAAGTTGT[G/A]GCGACAGCCGTGGAAGCCAACTGAAAGATCCAGGATGAAAAGCAAGGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link