sema6d

Ensembl ID:
ENSDARG00000002748
ZFIN ID:
ZDB-GENE-040426-1933
Description:
semaphorin-6C [Source:RefSeq peptide;Acc:NP_998164]
Human Orthologue:
SEMA6C
Human Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C [Source:HGNC Symbol;
Mouse Orthologue:
Sema6c
Mouse Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C Gene [Source:MGI Sym

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11733 Essential Splice Site Available for shipment Available now
sa3000 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa11733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091031 Essential Splice Site 173 880 7 18
ENSDART00000136361 Essential Splice Site 191 898 7 18
Genomic Location (Zv9):
Chromosome 19 (position 419730)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 409661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAAGATGTCCATTTGAGTCTCGACAGTCCAATGTWGGARTGTTTGCAG[G/A]TGAAACACACACASAGAYGGATGTGAARATATATACACCTGCAAAATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3000
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091031 Nonsense 225 880 9 18
ENSDART00000136361 Nonsense 243 898 9 18
Genomic Location (Zv9):
Chromosome 19 (position 420848)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 410779
KASP Assay ID:
554-2467.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTTGTTTTGTTTCTGCAGAGCCTCATTTCCTGCACGCTGTCGAATA[C/A]GGGAACTATGTGTATTTCTTCTTCAGTGAGATYGCTGTGGAGCACACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link