tdh

Ensembl ID:
ENSDARG00000002745
ZFIN ID:
ZDB-GENE-040426-2379
Description:
L-threonine 3-dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_998410]
Mouse Orthologue:
Tdh
Mouse Description:
L-threonine dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1926231]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4889 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025509 Essential Splice Site 209 375 6 9
ENSDART00000147105 Essential Splice Site 209 375 6 9

The following transcripts of ENSDARG00000002745 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 19068363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGCACTATATATGGCGTTTCTAAAGTCCATGCAGAGCTTATGGGAGAG[G/A]TAAAGACACAAGTCACCAAGTATTTCACATATTATCAGTTAATTGTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f7ka9nh5