kiss1ra

Ensembl ID:
ENSDARG00000002728
ZFIN ID:
ZDB-GENE-070912-521
Description:
KISS1 receptor a [Source:RefSeq peptide;Acc:NP_001099149]
Human Orthologue:
KISS1R
Human Description:
KISS1 receptor [Source:HGNC Symbol;Acc:4510]
Mouse Orthologue:
Kiss1r
Mouse Description:
KISS1 receptor Gene [Source:MGI Symbol;Acc:MGI:2148793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25849 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008492 Nonsense 65 368 1 6
ENSDART00000041353 Nonsense 65 355 1 6
ENSDART00000124647 Nonsense 65 366 1 5
Genomic Location (Zv9):
Chromosome 2 (position 33514274)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33813181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGGGGCTGATCGGAAACTCACTGGTGATTTATGTCATCTCCAAACAC[A/T]GACAGATGAGGACGGCTACTAACTTTTACATAGGTGAGTCTGAGCCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link