ncl

Ensembl ID:
ENSDARG00000002710
ZFIN ID:
ZDB-GENE-030131-6986
Description:
nucleolin [Source:RefSeq peptide;Acc:NP_001070120]
Human Orthologue:
NCL
Human Description:
nucleolin [Source:HGNC Symbol;Acc:7667]
Mouse Orthologue:
Ncl
Mouse Description:
nucleolin Gene [Source:MGI Symbol;Acc:MGI:97286]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11342 Essential Splice Site, Splice Site Available for shipment Available now
sa37569 Nonsense Mutation detected in F1 DNA During 2017
sa39385 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017188 Essential Splice Site 169 705 6 17
ENSDART00000124698 Splice Site None 704 None 17
ENSDART00000125916 Splice Site None 673 None 18
ENSDART00000130171 Splice Site None 387 None 17

The following transcripts of ENSDARG00000002710 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39568983)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36717733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCAAATGCACAATGCRTCATCTAAATCRATGTCTTTGCTTCMATTTG[C/T]GAAGATGAATCTGAAGAGGAAGAAGCTCCGCCTCCTAAAAAAGCTGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017188 Nonsense 495 705 13 17
ENSDART00000124698 Nonsense 494 704 13 17
ENSDART00000125916 Nonsense 494 673 13 18
ENSDART00000130171 Nonsense 177 387 13 17

The following transcripts of ENSDARG00000002710 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39561603)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36710353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACTCCCTCCAGAGTGTGTTCGAGAAGGCCGTGTCCATCAGAATACCA[C/T]AGAACAACGGCAGACCCAAAGGGTACGGCAAAATTACTGCAATTTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017188 Nonsense 630 705 16 17
ENSDART00000124698 Nonsense 629 704 16 17
ENSDART00000125916 Nonsense 629 673 16 18
ENSDART00000130171 Nonsense 312 387 16 17

The following transcripts of ENSDARG00000002710 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39556898)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36705648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACGGAGAGATCGACGGAAACAAAGTGACTCTGGACTACGCCAAGCCC[A/T]AAGGAGAAGGTGGACGAGGAGGATTCGGCGGAGGAAGAGGAGGCTTTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link