gnb3b

Ensembl ID:
ENSDARG00000002696
ZFIN ID:
ZDB-GENE-040426-2280
Description:
guanine nucleotide binding protein (G protein), beta polypeptide 3b [Source:RefSeq peptide;Acc:NP_9
Human Orthologue:
GNB3
Human Description:
guanine nucleotide binding protein (G protein), beta polypeptide 3 [Source:HGNC Symbol;Acc:4400]
Mouse Orthologue:
Gnb3
Mouse Description:
guanine nucleotide binding protein (G protein), beta 3 Gene [Source:MGI Symbol;Acc:MGI:95785]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25084 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23424 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005547 Essential Splice Site 89 338 4 9
ENSDART00000132642 Essential Splice Site 89 338 4 9
Genomic Location (Zv9):
Chromosome 19 (position 5746099)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5205410
KASP Assay ID:
554-7437.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACAGGATGGCAAACTTCTCATCTGGGATGCTCACTCTGGAAATAAG[G/A]TGATTTAAGTGAAGTTTTGTGAAATTTCGAGAGGAGCACGTGCTTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005547 Nonsense 169 338 7 9
ENSDART00000132642 Nonsense 169 338 7 9
Genomic Location (Zv9):
Chromosome 19 (position 5737665)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5196976
KASP Assay ID:
2261-2848.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAATTCCTTCAATTTCTTCACATTTGTTTTCCAGTGCACTGTGGGATT[T/A]GGAGACTGGAAAGCAAAAGACGGTTTTCCTGAACCACATTGGCGACTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link