mapre1

Ensembl ID:
ENSDARG00000002659
ZFIN ID:
ZDB-GENE-040426-2256
Description:
microtubule-associated protein, RP/EB family, member 1 [Source:RefSeq peptide;Acc:NP_998805]
Human Orthologue:
MAPRE1
Human Description:
microtubule-associated protein, RP/EB family, member 1 [Source:HGNC Symbol;Acc:6890]
Mouse Orthologue:
Mapre1
Mouse Description:
microtubule-associated protein, RP/EB family, member 1 Gene [Source:MGI Symbol;Acc:MGI:891995]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4238 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004474 None None 258 1 7
ENSDART00000129167 Nonsense 23 325 1 8
ENSDART00000136740 None None 258 None 7

The following transcripts of ENSDARG00000002659 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 9914468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAAAGACTCTTAATTTGCCATATATGTTTTNNGCACAATACGTTCCCTG[C/A]GTAGCTCTACGCGATGACGTCAAGCAGCCAAAGAACAAACCGACGCATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r1g29w8f