rgs5a

Ensembl ID:
ENSDARG00000002644
ZFIN ID:
ZDB-GENE-030131-7570
Description:
regulator of G-protein signaling 5 [Source:RefSeq peptide;Acc:NP_956256]
Human Orthologue:
RGS5
Human Description:
regulator of G-protein signaling 5 [Source:HGNC Symbol;Acc:10001]
Mouse Orthologue:
Rgs5
Mouse Description:
regulator of G-protein signaling 5 Gene [Source:MGI Symbol;Acc:MGI:1098434]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31521 Nonsense Available for shipment Available now
sa17283 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016586 Nonsense 20 182 2 6
ENSDART00000073784   49 95 2 3
ENSDART00000127612 Nonsense 20 182 2 5
Genomic Location (Zv9):
Chromosome 6 (position 34348167)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35415320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATCTGTATGTATTTGTGTTTGTGTTGTCTTCAGGGCTAAAGAGATC[A/T]AGACTAAATTGGGAACTCTGCTTCAGAAGCCAGAGAATTCCATCGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016586 Essential Splice Site 53 182 None 6
ENSDART00000073784 Essential Splice Site 83 95 None 3
ENSDART00000127612 Essential Splice Site 53 182 None 5
Genomic Location (Zv9):
Chromosome 6 (position 34351780)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35411707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTAAAGATAAAAATGTAACTAAATRAAWAAATCTGCCTGYTTTGTTC[A/T]GGGCCACRCCTGAARAAGCWGCCCAATGGCGCGAGTCCCTTGATAAGGTY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link