sh3gl1b

Ensembl ID:
ENSDARG00000002642
ZFIN ID:
ZDB-GENE-031001-6
Description:
endophilin-A2 [Source:RefSeq peptide;Acc:NP_958905]
Human Orthologue:
SH3GL1
Human Description:
SH3-domain GRB2-like 1 [Source:HGNC Symbol;Acc:10830]
Mouse Orthologue:
Sh3gl1
Mouse Description:
SH3-domain GRB2-like 1 Gene [Source:MGI Symbol;Acc:MGI:700010]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2439 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa2439
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100491 Essential Splice Site 288 351 8 9
Genomic Location (Zv9):
Chromosome 8 (position 19372539)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18817177
KASP Assay ID:
554-3002.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAACGGTGGCTACACCCCATCATCTGCTCCACCGATGCGCAATGCAGG[T/C]AAGAGCAGTCAYAAAATACANNGTTTCCTATTGTGCTGTCAGTATKAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link