b4galt1

Ensembl ID:
ENSDARG00000002634
ZFIN ID:
ZDB-GENE-050417-236
Description:
beta-1,4-galactosyltransferase 1 [Source:RefSeq peptide;Acc:NP_001017730]
Human Orthologue:
B4GALT1
Human Description:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 [Source:HGNC Symbol;Acc:924]
Mouse Orthologue:
B4galt1
Mouse Description:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:95

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38251 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011977 Essential Splice Site 183 214 None 4
ENSDART00000054801 Missense 184 213 2 3
ENSDART00000103445 Essential Splice Site 183 318 None 5
ENSDART00000109161 Essential Splice Site 164 345 None 8
Genomic Location (Zv9):
Chromosome 1 (position 11451956)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11468785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTTAAAGAGACAGCTGCTGGATTATGGGATTTATATCATAGAACAGG[T/C]ACAGAAACTCACTTGTTATTTATTTCTACTCGGGCTGCACAATATCGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link