pip5k1a

Ensembl ID:
ENSDARG00000002614
ZFIN ID:
ZDB-GENE-050522-517
Description:
phosphatidylinositol-4-phosphate 5-kinase type-1 gamma [Source:RefSeq peptide;Acc:NP_001018438]
Human Orthologue:
PIP5K1A
Human Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha [Source:HGNC Symbol;Acc:8994]
Mouse Orthologue:
Pip5k1a
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha Gene [Source:MGI Symbol;Acc:MGI:107929]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12107 Nonsense Available for shipment Available now
sa12937 Nonsense Available for shipment Available now
sa9126 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078358 Nonsense 44 559 4 16
Genomic Location (Zv9):
Chromosome 19 (position 11903228)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10991959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCAGCACCTTGGGTTCATCCCARACAAACAAAAAGACCTTGGGYCAC[C/T]GAGGGATTGACCCCACTGGGGAGACCACATATAAAAAGGTGGGAGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078358 Nonsense 119 559 6 16
Genomic Location (Zv9):
Chromosome 19 (position 11904197)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10990990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAGCTCAACGCCGGGTCATCACCAYGGTGACTTCAAGTTTAAAACWTA[C/A]GCTCCCATTGCATTCCGATACTTCAGAGAGATGTTCGGGATCCGACCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078358 Essential Splice Site 290 559 8 16
Genomic Location (Zv9):
Chromosome 19 (position 11906241)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10988946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGACCACTACACWGCCCTCAGCAGGACCATGCAGAGAGACTGTCGGG[T/C]AAGAGCAYAGCTAGTGTTTTSCAGCCAATGATAAACATCCRGTGAAASDT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link