LOC565986

Ensembl ID:
ENSDARG00000002609
Human Orthologue:
RNF145
Human Description:
ring finger protein 145 [Source:HGNC Symbol;Acc:20853]
Mouse Orthologue:
Rnf145
Mouse Description:
ring finger protein 145 Gene [Source:MGI Symbol;Acc:MGI:1921565]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39008 Nonsense Mutation detected in F1 DNA During 2017
sa35724 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004550 Nonsense 327 649 7 10
Genomic Location (Zv9):
Chromosome 14 (position 36159623)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34660951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCAGAGGCATGACGGAGGGAATCACTCTTTTGATTCTGGCTGTT[C/T]AGACGGGACTCATCGAGCTGCAGGTCATCCACAGAGCCTTCCTCTTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004550 Nonsense 431 649 9 10
Genomic Location (Zv9):
Chromosome 14 (position 36162112)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34663440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTTTTGGGCTCTCTAAACTGCAGGTTCTGGGCACGCTGCTGATCTA[T/G]GTGCTCTTCATGGTGGAGGAGCTGCGCAAGGCTCCGGTGGAGAACATGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link