asap1

Ensembl ID:
ENSDARG00000002607
Human Orthologues:
ASAP1, ASAP2, ASAP3
Human Descriptions:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 [Source:HGNC Symbol;Acc:2720]
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:2721]
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:14987]
Mouse Orthologues:
6530401G17Rik, Asap1, Asap3
Mouse Descriptions:
ArfGAP with SH# domain, ankyrin repeat and PH domain1 Gene [Source:MGI Symbol;Acc:MGI:1342335]
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2684986]
RIKEN cDNA 6530401G17 gene Gene [Source:MGI Symbol;Acc:MGI:1923478]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6210 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7669 Nonsense Mutation detected in F1 DNA During 2014
sa6211 Nonsense Mutation detected in F1 DNA During 2014
sa7350 Missense Mutation detected in F1 DNA During 2014
sa21921 Essential Splice Site Available for shipment Available now
sa1614 Nonsense Available for shipment Available now
sa4423 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103507 Essential Splice Site 254 1018 8 28
Genomic Location:
Chromosome 11 (position 27442752)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAAGCTGAAGCAGTACATTGATGCCCTCRCAGGACAGCTGAGCGCAG[T/C]GAGTGATTCTTGCATGCCAAYGATTGTACAAATGTATTCTGTGAATCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103507 Nonsense 262 1018 9 28
Genomic Location:
Chromosome 11 (position 27447842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTAANNGTGTGTGTGTGTGTTTTACAGATCAAACATAAGCAGGATGAG[G/T]AGAAGAGACAGCTCTGTTCTCTCCGAGATCAGCTCAGACCGGCTCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103507 Nonsense 303 1018 10 28
Genomic Location:
Chromosome 11 (position 27454476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGACAGACYGTATACAGCAWGCATCAGCTTCAAGGCAACAAGCAATA[T/A]GGTACAGAGAAATCCGGCTACCTCTACAAGAGGAGTGATGGGTAAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103507 Missense 454 1018 15 28
Genomic Location:
Chromosome 11 (position 27465945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTTTCAGATCCGAGTTGGATCTCTATAAACCTGGGAATCCTGACA[T/A]GCATTGAGTGCTCAGGGATCCATCGGGAGATGGGTGTACATTATTCACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103507 Essential Splice Site 516 1018 17 28
Genomic Location:
Chromosome 11 (position 27469010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGACTCAATAAAACAGAGAGTGTACTTAAATATGTGGTGTTATTCGC[A/C]GGGCTGTACGCAAGGACTTTATACTCTCGAAATACATGGAGTGGCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103507 Nonsense 534 1018 17 28
Genomic Location:
Chromosome 11 (position 27469064)
KASP Assay ID:
554-1555.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTACGCAAGGACTTTATACTCTCGAAATACATGGAGTGGCAGTTTGCA[C/T]AGCGCAGCGGCGGCTCACTGGAAACAAAGCGCAAATATCTGCAGGACGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa4423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103507 Nonsense 776 1018 22 28
Genomic Location:
Chromosome 11 (position 27479437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTCACAGACGCGCAGCCTGGACAGTCCACCTCCACCACCTCCTTCAT[C/A]ACCCGCACCACCACTGCCACCCCGGGTCAGAGGTARGARAAAGACCACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Multiple sclerosis: Genome-wide association study identifies new multiple sclerosis susceptibility loci on chromosomes 12 and 20. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sxf6o8cm