pcsk1

Ensembl ID:
ENSDARG00000002600
ZFIN ID:
ZDB-GENE-071009-1
Description:
neuroendocrine convertase 1 [Source:RefSeq peptide;Acc:NP_001131134]
Human Orthologue:
PCSK1
Human Description:
proprotein convertase subtilisin/kexin type 1 [Source:HGNC Symbol;Acc:8743]
Mouse Orthologue:
Pcsk1
Mouse Description:
proprotein convertase subtilisin/kexin type 1 Gene [Source:MGI Symbol;Acc:MGI:97511]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9109 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1558 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014668 Essential Splice Site 135 755 3 14
ENSDART00000147473 Essential Splice Site 135 754 3 14
Genomic Location (Zv9):
Chromosome 21 (position 10111527)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11594890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTRGACAAACTCTTCGATGACCCCATGTGGAAYMAGCAGTGGTATCTGG[T/A]GAGTCTTGTTGTYTTAATATTCCTTTGGCAAAAGTGGRATTTGGATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014668 Essential Splice Site 184 755 4 14
ENSDART00000147473 Essential Splice Site 184 754 4 14
Genomic Location (Zv9):
Chromosome 21 (position 10123772)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11607135
KASP Assay ID:
554-1501.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGGATGACGGTCTGGAGTGGAACCACACCGACATTTATCCAAACTAC[G/A]TAAGTGACACCTACTACAACTAGACTACTGGTATAGGAGGCCACAAACAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link