pabpc1l

Ensembl ID:
ENSDARG00000002597
ZFIN ID:
ZDB-GENE-030131-5836
Description:
polyadenylate-binding protein 1-like [Source:RefSeq peptide;Acc:NP_956133]
Human Orthologues:
PABPC1L, RBMS1, RBMS2, RBMS3
Human Descriptions:
poly(A) binding protein, cytoplasmic 1-like [Source:HGNC Symbol;Acc:15797]
RNA binding motif, single stranded interacting protein 1 [Source:HGNC Symbol;Acc:9907]
RNA binding motif, single stranded interacting protein 2 [Source:HGNC Symbol;Acc:9909]
RNA binding motif, single stranded interacting protein 3 [Source:HGNC Symbol;Acc:13427]
Mouse Orthologues:
Pabpc1l, Rbms1, Rbms2, Rbms3
Mouse Descriptions:
poly(A) binding protein, cytoplasmic 1-like Gene [Source:MGI Symbol;Acc:MGI:1922908]
RNA binding motif, single stranded interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1861774]
RNA binding motif, single stranded interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1861776]
RNA binding motif, single stranded interacting protein Gene [Source:MGI Symbol;Acc:MGI:2444477]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16293 Nonsense Available for shipment Available now
sa2423 Nonsense Available for shipment Available now
sa41286 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004546 Nonsense 167 620 4 15
ENSDART00000126848 Nonsense 167 620 4 16
ENSDART00000134161 Nonsense 167 557 4 13
ENSDART00000142322   None 147 None 3
ENSDART00000145011 Nonsense 167 557 4 13
Genomic Location (Zv9):
Chromosome 8 (position 47184177)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45331036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTAACAGAGCAATTGAGACGATGAATGGCATGCTTCTGAATGATCGC[A/T]AAGTGTACGTTTAATTAATGCAGTATGTGGTACAGAGTTYCTTTTAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004546 Nonsense 277 620 7 15
ENSDART00000126848 Nonsense 277 620 7 16
ENSDART00000134161 Nonsense 277 557 7 13
ENSDART00000142322   None 147 None 3
ENSDART00000145011 Nonsense 277 557 7 13
Genomic Location (Zv9):
Chromosome 8 (position 47181679)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45333534
KASP Assay ID:
554-2724.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTATGTRGGCAGAGCTCAGAAAAGACTCGAGAGGCAGGGAGAGCTC[A/T]AGCGCAAGTTTGAGCAAATTAAGCAAGAGCGCATACAACGTTACCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004546 Nonsense 552 620 13 15
ENSDART00000126848 Nonsense 552 620 13 16
ENSDART00000134161 Nonsense 552 557 13 13
ENSDART00000142322   None 147 None 3
ENSDART00000145011 Nonsense 552 557 13 13
Genomic Location (Zv9):
Chromosome 8 (position 47173879)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45341334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCCAGGAGCCCCTTACTGCCTCAATGCTGGCAGCTGCACCTTTAAAA[G/T]AGCAGAAACAACTACTGGGTAAGTGAAGCTTACTTAAACCAGTGGTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link