ENSDARG00000002585

Ensembl ID:
ENSDARG00000002585
Human Orthologue:
PITPNM3
Human Description:
PITPNM family member 3 [Source:HGNC Symbol;Acc:21043]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14941 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005305 Nonsense 184 397 5 8
Genomic Location:
Chromosome 21 (position 38746522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAACCACACGTTTTGATTGCTTTCCAGACACTGGCAGGATCTGGGATA[T/A]CTGATCATCTACATCACRGGCCGTCCTGACATGCAGAAGCAGAGGGTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/53c0e3wa