tmod2

Ensembl ID:
ENSDARG00000002571
ZFIN ID:
ZDB-GENE-040912-185
Description:
tropomodulin-2 [Source:RefSeq peptide;Acc:NP_001004608]
Human Orthologues:
TMOD2, TMOD3
Human Descriptions:
tropomodulin 2 (neuronal) [Source:HGNC Symbol;Acc:11872]
tropomodulin 3 (ubiquitous) [Source:HGNC Symbol;Acc:11873]
Mouse Orthologues:
Tmod2, Tmod3
Mouse Descriptions:
tropomodulin 2 Gene [Source:MGI Symbol;Acc:MGI:1355335]
tropomodulin 3 Gene [Source:MGI Symbol;Acc:MGI:1355315]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29074 Essential Splice Site Mutation detected in F1 DNA During 2015
sa17697 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012164 Essential Splice Site 202 344 6 10
ENSDART00000130473 Essential Splice Site 202 344 5 10
Genomic Location:
Chromosome 18 (position 37805192)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGCCAATGATCCCACGTTGACTGAAGTCAATCTCAACAACATCAAGG[T/C]AATGAGACTTATCCACTAAATGTGTTCTAATGAGACATTAAAAACATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012164 Essential Splice Site 286 344 8 10
ENSDART00000130473 Essential Splice Site 286 344 7 10
Genomic Location:
Chromosome 18 (position 37810921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTTCGAGACAACGACACGCTTTCAGAGATCAAGATCKACAACCAGG[T/A]AAGGTCACAAGCACATACTGACYGTCACAAACTGTTAATGGTCGTTTTTR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/th829h61