mapkapk2a

Ensembl ID:
ENSDARG00000002552
ZFIN ID:
ZDB-GENE-030131-5532
Description:
MAP kinase-activated protein kinase 2 [Source:RefSeq peptide;Acc:NP_958460]
Human Orthologue:
MAPKAPK2
Human Description:
mitogen-activated protein kinase-activated protein kinase 2 [Source:HGNC Symbol;Acc:6887]
Mouse Orthologue:
Mapkapk2
Mouse Description:
MAP kinase-activated protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:109298]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11786 Nonsense Available for shipment Available now
sa24891 Nonsense Mutation detected in F1 DNA During 2014
sa13320 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027532 Nonsense 2 382 1 10
Genomic Location:
Chromosome 11 (position 22050918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGTAGKTAGCAGTTTTAAGTACGAGAAKAAAAGAGGTGGGAGATGT[T/A]GACTAACGCCAACAGTCCGCCRAAGTTTCCAAACCAACAGCAGCARCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027532 Nonsense 235 382 6 10
Genomic Location:
Chromosome 11 (position 21991796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGTATGACAAGTCCTGTGACATGTGGTCTTTGGGTGTCATCATGTA[T/A]ATTCTGTAAGTGAATTTGTCTCATGTGTTTTGCTTGCTTGCATCATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027532 Nonsense 348 382 10 10
Genomic Location:
Chromosome 11 (position 21989694)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTACAGGAGGAAATGACTAGTGCCTTGGCAACRATGAGAGTCGACTA[T/A]GAGCAAATCAAAATCAAGAGGATTGAAGACTCGACCAATCCGCTGCTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kpo8mzl1