eif3eb

Ensembl ID:
ENSDARG00000002549
ZFIN ID:
ZDB-GENE-050208-283
Description:
Eukaryotic translation initiation factor 3 subunit E-B [Source:UniProtKB/Swiss-Prot;Acc:Q1LUA8]
Human Orthologue:
EIF3E
Human Description:
eukaryotic translation initiation factor 3, subunit E [Source:HGNC Symbol;Acc:3277]
Mouse Orthologue:
Eif3e
Mouse Description:
eukaryotic translation initiation factor 3, subunit E Gene [Source:MGI Symbol;Acc:MGI:99257]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10543 Essential Splice Site Available for shipment Available now
sa23512 Nonsense Mutation detected in F1 DNA During 2014
sa6144 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023926 Essential Splice Site 158 446 5 13
ENSDART00000064209 Essential Splice Site 158 401 5 12
ENSDART00000135651 Essential Splice Site 158 401 5 15
ENSDART00000136295 Essential Splice Site 158 439 5 13
Genomic Location:
Chromosome 19 (position 23142181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAACTACTCTGGAGCTGCAGAGTATCYCTACTTTTTCCGCGTGCTTG[T/A]AAGCAAGASCACTAATGTTTCATTTAGTTTTTGTTTGTTTGYTTAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023926 Nonsense 171 446 6 13
ENSDART00000064209 Nonsense 171 401 6 12
ENSDART00000135651 Nonsense 171 401 6 15
ENSDART00000136295 Nonsense 171 439 6 13
Genomic Location:
Chromosome 19 (position 23140027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATGATCCAGGTTCCCTCCACAGACAGGAATGCTCTGAGCTCTCTGT[G/A]GGGCAAACTGGCATCGGAAATCCTCATGCAGAATTGGGAAGCAGCCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023926 None None 446 None 13
ENSDART00000064209 None 402 401 None 12
ENSDART00000135651 Essential Splice Site 402 401 12 15
ENSDART00000136295 None None 439 None 13
Genomic Location:
Chromosome 19 (position 23111217)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCKGTCCTGCAGCTCCCACRGTACAGCCGCAGAAATGCAGACCTCTAAT[G/T]TGGGTAGACAAGTTTGGRTACTCGTCWGGTGTGTGCCCCCACTGTGYCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nkzbeq3v