tm9sf4

Ensembl ID:
ENSDARG00000002536
ZFIN ID:
ZDB-GENE-040426-1575
Description:
transmembrane 9 superfamily protein member 4 [Source:RefSeq peptide;Acc:NP_956804]
Human Orthologue:
TM9SF4
Human Description:
transmembrane 9 superfamily protein member 4 [Source:HGNC Symbol;Acc:30797]
Mouse Orthologue:
Tm9sf4
Mouse Description:
transmembrane 9 superfamily protein member 4 Gene [Source:MGI Symbol;Acc:MGI:2139220]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8000 Nonsense Mutation detected in F1 DNA During 2014
sa19316 Nonsense Mutation detected in F1 DNA During 2014
sa1226 Nonsense Available for shipment Available now
sa13048 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006765 Nonsense 112 651 4 18
ENSDART00000011554 Nonsense 102 314 4 16
ENSDART00000006765 Nonsense 112 651 4 18
ENSDART00000011554 Nonsense 102 314 4 16
Genomic Location:
Chromosome 23 (position 7628263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTTTTATGAATCTGGACAAGAAGTGTGAGGTGTTGTGTAAAAAACCT[G/T]AAAGTCCCATCAAACTCTCAGTGGAGGAGAGTAAACTGCTAGCRGAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006765 Nonsense 112 651 4 18
ENSDART00000011554 Nonsense 102 314 4 16
ENSDART00000006765 Nonsense 112 651 4 18
ENSDART00000011554 Nonsense 102 314 4 16
Genomic Location:
Chromosome 23 (position 7628263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTTTATGAATCTGGACAAGAAGTGTGAGGTGTTGTGTAAAAAACCT[G/T]AAAGTCCCATCAAACTCTCAGTGGAGGAGAGTAAACTGCTAGCAGAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006765 Nonsense 474 651 14 18
ENSDART00000011554 None None 314 12 16
Genomic Location:
Chromosome 23 (position 7645977)
KASP Assay ID:
554-1135.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGGCTCTGTTGTGCATGTGGTTTGGTATCTCGTTGCCKCTCGTGTA[T/A]CTGGGCTATTACTTTGGTTTTCGCAAGCAGCCRTATGACAATCCAGTCCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006765 Nonsense 590 651 17 18
ENSDART00000011554 None None 314 15 16
Genomic Location:
Chromosome 23 (position 7650259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCGGTGGTGGTGGAGGACKTTCCTTGTGTCTGGAGRATCTGCCTTCTA[C/A]GTCCTKATCTATGCCATTTTCTATTWCGTCAACAAGGTAACCTTCAGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/igrxlady