dmbx1b

Ensembl ID:
ENSDARG00000002510
ZFIN ID:
ZDB-GENE-050417-97
Description:
Diencephalon/mesencephalon homeobox protein 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q566X8]
Human Orthologue:
DMBX1
Human Description:
diencephalon/mesencephalon homeobox 1 [Source:HGNC Symbol;Acc:19026]
Mouse Orthologue:
Dmbx1
Mouse Description:
diencephalon/mesencephalon homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:2153518]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38535 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026693 Nonsense 113 369 4 5
Genomic Location (Zv9):
Chromosome 6 (position 3374153)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3406553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACTGAAGTTTTTCATTGCATTTCAATGTCTTCACATTTCCAGGTGTG[G/A]TTTAAAAACCGGCGTGCAAAGTTTCGCAAAAAGCAGCGCAGCTTGCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link