LOC569518

Ensembl ID:
ENSDARG00000002508
Human Orthologue:
ANKRD33
Human Description:
ankyrin repeat domain 33 [Source:HGNC Symbol;Acc:13788]
Mouse Orthologue:
Ankrd33
Mouse Description:
ankyrin repeat domain 33 Gene [Source:MGI Symbol;Acc:MGI:2443398]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15313 Nonsense Available for shipment Available now
sa5377 Nonsense Mutation detected in F1 DNA During 2014
sa18846 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023686 Nonsense 35 462 1 4
Genomic Location:
Chromosome 6 (position 39211040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGATGGRGWTGAAATCTCACTTTTGGATGAAGACACAGACTCTGGAAGTT[T/A]GCTGTCTGAAGATTCCGTGCTCCCTGAGTATGAACTAGAGGATGGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023686 Nonsense 353 462 4 4
ENSDART00000023686 Nonsense 353 462 4 4
Genomic Location:
Chromosome 6 (position 39216219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGTCTCCATCTTTCCATTCAGCCGAGTTYGTGTCTATGACCTGCTG[T/A]CCCGATACTGAGAGACGGGGCAGTGTGCTGTCCATTGGTATGCGCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023686 Nonsense 353 462 4 4
ENSDART00000023686 Nonsense 353 462 4 4
Genomic Location:
Chromosome 6 (position 39216219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTCTCCATCTTTCCATTCAGCCGAGTTTGTGTCTATGACCTGCTG[T/A]CCCGATACTGAGAGACGGGGCAGTGTGCTGTCCATTGGTATGCGCACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/og0szqdp