itga10

Ensembl ID:
ENSDARG00000002507
ZFIN ID:
ZDB-GENE-100922-54
Human Orthologue:
ITGA10
Human Description:
integrin, alpha 10 [Source:HGNC Symbol;Acc:6135]
Mouse Orthologue:
Itga10
Mouse Description:
integrin, alpha 10 Gene [Source:MGI Symbol;Acc:MGI:2153482]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22786 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11418 Essential Splice Site Available for shipment Available now
sa15068 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011224 Essential Splice Site 595 1170 14 30
ENSDART00000139859 Essential Splice Site 595 1174 15 31
Genomic Location:
Chromosome 16 (position 16064754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACATCTACCATGGCGATGAATACTACATCATACCTCAGTATAAACAAG[T/G]AAATATAGCACCGTTTCATGGTTACAGACAGATCAATGGGTTAGTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011224 Essential Splice Site 742 1170 17 30
ENSDART00000139859 Essential Splice Site 746 1174 18 31
Genomic Location:
Chromosome 16 (position 16058355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTCGTGTTGGAGAGACCAAGTGCTACATCTTGCCATTTCACGTTTTT[G/A]TAAGTCTTCAGAAAATCAATGAAGCAATGGAAATGTACATTTAGTCGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011224 Essential Splice Site 1114 1170 28 30
ENSDART00000139859 Essential Splice Site 1118 1174 29 31
Genomic Location:
Chromosome 16 (position 16050687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGAGAGTCCAATCTGATTACAWTGGGAAATGCTGCCCTCTTGAGGGAG[G/A]TGAGAGAACTGRRACTTTAAATTAGATGACTGGTACCGGTCAAAGATRAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zrmjv4dr