im:7165241

Ensembl ID:
ENSDARG00000002494
ZFIN IDs:
ZDB-GENE-090218-34, ZDB-GENE-100812-2
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A7MC25]
Human Orthologue:
ITGB6
Human Description:
integrin, beta 6 [Source:HGNC Symbol;Acc:6161]
Mouse Orthologue:
Itgb6
Mouse Description:
integrin beta 6 Gene [Source:MGI Symbol;Acc:MGI:96615]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6193 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065933 Essential Splice Site 111 782 3 16
Genomic Location (Zv9):
Chromosome 11 (position 11051770)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11004084
KASP Assay ID:
554-5361.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGTGTCATACATCGCACCGCAGAAGATGCGCCTCCAGCTTAGACCAG[G/A]TAAAACTGGGTGACACAGATTTGAAAATCAAAGAAATGTCTCTGTCAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link