noc3l

Ensembl ID:
ENSDARG00000002487
ZFIN ID:
ZDB-GENE-030131-9878
Description:
Nucleolar complex protein 3 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DRN3]
Human Orthologue:
NOC3L
Human Description:
nucleolar complex associated 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24034]
Mouse Orthologue:
Noc3l
Mouse Description:
nucleolar complex associated 3 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1932610]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35204 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41960 Nonsense Mutation detected in F1 DNA During 2017
sa9387 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9316 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028043 Essential Splice Site 74 800 2 21

The following transcripts of ENSDARG00000002487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6370124)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5381201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCCATCAGACCCTCAAACCCCTGGAGCGCTACAAGAAGAGACCCGG[T/C]GAGCCAACATTGGTTTCTGGGTTGTTTTGCATGAGCTCAGTGCTGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028043 Nonsense 305 800 8 21

The following transcripts of ENSDARG00000002487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6376100)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5375225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGACGCTGCAGCTCAGAGAGTTTGAGGAGGGTCTGGTCAGCCAGTA[T/G]AAGTTTTACCTGGAGGAGCTGGAACAGACAGTCAAAGGTAGATCTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028043 Essential Splice Site 318 800 9 21
ENSDART00000028043 Essential Splice Site 318 800 9 21

The following transcripts of ENSDARG00000002487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6376208)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5375117
KASP Assay ID:
2260-4929.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACYTGTTCATCCATTGTTTGTTTGTCTGACTGATCTGCTGTCGTTTCA[G/T]ACTGGAAGCAGAAGAAGGAGAAGAGAAGTCAGGCCGTGTCTCTGCAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028043 Essential Splice Site 318 800 9 21
ENSDART00000028043 Essential Splice Site 318 800 9 21

The following transcripts of ENSDARG00000002487 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6376208)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5375117
KASP Assay ID:
2260-4929.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACYTGTTCATCCATTGTTTGTTTGTCTGACTGATCTGCTGTCGTTTCA[G/T]ACTGGAAGCAGAAGAAGGAGAAGAGAAGTCAGGCCGTGTCTCTGCAGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link