si:ch211-278b8.3

Ensembl ID:
ENSDARG00000002479
ZFIN ID:
ZDB-GENE-060531-56
Description:
DNA excision repair protein ERCC-6-like [Source:UniProtKB/Swiss-Prot;Acc:A2BGR3]
Human Orthologue:
ERCC6L
Human Description:
excision repair cross-complementing rodent repair deficiency, complementation group 6-like [Source:H
Mouse Orthologue:
Ercc6l
Mouse Description:
excision repair cross-complementing rodent repair deficiency complementation group 6 - like Gene [So

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40415 Nonsense Mutation detected in F1 DNA During 2017
sa2215 Nonsense F2 line generated During 2017
sa20402 Nonsense Available for shipment Available now
sa31433 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 299 1451 3 4
Genomic Location (Zv9):
Chromosome 5 (position 25589391)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23416656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGCCAAGGATCACTCTTGGGAACCTCCAAAACGTTCAAAACCGAGTA[T/A]GAGAATCCAATCACACGAGCAAGGGAGAAAGATGCCACACCTGGGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2215
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 359 1451 3 4
Genomic Location (Zv9):
Chromosome 5 (position 25589569)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23416834
KASP Assay ID:
554-2743.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGCAGAAAAAACTAAAGCTTGAAGAAGGCTTTGAAGAGGAAGAAGAT[C/T]AAGAGAATAAATGTCCAAATGCTAGAGAAGGCGTAGAGATGCCGTCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 1081 1451 4 4
ENSDART00000015401 Nonsense 1081 1451 4 4
Genomic Location (Zv9):
Chromosome 5 (position 25594075)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23421340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCAAGTATCAACCATGACAAACAAAACAATGGGGAGTTTGTCAATTA[T/A]AACGACAGTGAAGTCAGCAAACGTGAATCTCTTTTAAAGATCCGTTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015401 Nonsense 1081 1451 4 4
ENSDART00000015401 Nonsense 1081 1451 4 4
Genomic Location (Zv9):
Chromosome 5 (position 25594075)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23421340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCAAGTATCAACCATGACAAACAAAACAATGGGGAGTTTGTCAATTA[T/A]AACGACAGTGAAGTCAGCAAACGTGAATCTCTTTTAAAGATCCGTTCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link