ARHGEF37

Ensembl ID:
ENSDARG00000002463
Description:
Rho guanine nucleotide exchange factor (GEF) 37 [Source:HGNC Symbol;Acc:34430]
Human Orthologue:
ARHGEF37
Human Description:
Rho guanine nucleotide exchange factor (GEF) 37 [Source:HGNC Symbol;Acc:34430]
Mouse Orthologue:
Arhgef37
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 37 Gene [Source:MGI Symbol;Acc:MGI:3045339]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3278 Essential Splice Site Available for shipment Available now
sa22474 Essential Splice Site Available for shipment Available now
sa18496 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106039 Essential Splice Site 252 709 4 12
Genomic Location (Zv9):
Chromosome 14 (position 25852718)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24555809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCAGATCAACTGCAGGATCAATGAATACAAACGCTTCCGTGAAGTGGG[T/A]GAGAGAACATGCTCGCAATTTATCACGCAAAGCTGGCTGAACACAAGTAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106039 Essential Splice Site 368 709 7 12
Genomic Location (Zv9):
Chromosome 14 (position 25855189)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24558280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAAAGAAATCACAGTGGCGCTCAGACAGTGGATATACCCCTCATATG[T/A]AAGACTTTTAGATAATTATTACAGTTTGTGTCCCTGGGCCACAATACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106039 Nonsense 498 709 9 12
Genomic Location (Zv9):
Chromosome 14 (position 25859532)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24562623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGTGACTTCTGGAAGTGGGCAGAGACCTCTGTGCTGGAGGGTTCGTG[G/A]AGGATGGAGAGCCTGTGTCGGAGTRTTCAAGATGAGCTCAATGCTCCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link