prdm1a

Ensembl ID:
ENSDARG00000002445
ZFIN ID:
ZDB-GENE-030131-2193
Description:
PR domain zinc finger protein 1 [Source:RefSeq peptide;Acc:NP_955809]
Human Orthologue:
PRDM1
Human Description:
PR domain containing 1, with ZNF domain [Source:HGNC Symbol;Acc:9346]
Mouse Orthologue:
Prdm1
Mouse Description:
PR domain containing 1, with ZNF domain Gene [Source:MGI Symbol;Acc:MGI:99655]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9796 Nonsense Available for shipment Available now
sa6407 Nonsense Mutation detected in F1 DNA During 2017
sa22750 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017445 Nonsense 131 776 3 7
Genomic Location (Zv9):
Chromosome 16 (position 8656914)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7520168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTACACTGCAGAAAATGTCCCCAAAGATGCGAACAGGAAGTACTTCTG[G/A]CGGGTGAGTTGTTTTGTTTCWGAACATTTCAAGTAGCAGCAGATAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017445 Nonsense 622 776 7 7
Genomic Location (Zv9):
Chromosome 16 (position 8652099)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7515353
KASP Assay ID:
554-5124.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACCAGTGCAAGATCTGCCCAGCCAAGTTCACACAGTTTGTCCACCTC[A/T]AGCTGCACAAGCGGCTGCACACGCGAGAACGTCCACACCAATGCCCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017445 Nonsense 732 776 7 7
Genomic Location (Zv9):
Chromosome 16 (position 8651769)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7515023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTAAGGCGTCTTATCACAAAGGTAGCACTGGAGGGGACCTGCACCCC[C/T]GAGCGCCTGCATTATCCGCGTATCATCTGAATGAGCATGACAGTGAAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Systemic lupus erythematosus: Genome-wide association study in a Chinese Han population identifies nine new susceptibility loci for systemic lupus erythematosus. (View Study)
  • Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link