glud1b

Ensembl ID:
ENSDARG00000002414
ZFIN ID:
ZDB-GENE-030828-1
Description:
glutamate dehydrogenase 1b [Source:RefSeq peptide;Acc:NP_955839]
Human Orthologues:
GLUD1, GLUD2
Human Descriptions:
glutamate dehydrogenase 1 [Source:HGNC Symbol;Acc:4335]
glutamate dehydrogenase 2 [Source:HGNC Symbol;Acc:4336]
Mouse Orthologues:
AC160930.1, Glud1
Mouse Descriptions:
glutamate dehydrogenase 1 Gene [Source:MGI Symbol;Acc:MGI:95753]
glutamate dehydrogenase 1, mitochondrial precursor [Source:RefSeq peptide;Acc:NP_032159]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27954 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2641 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa27954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026657 Essential Splice Site 337 542 7 13
ENSDART00000101042 Essential Splice Site 337 542 7 13
ENSDART00000145078   None 410 None 12
Genomic Location (Zv9):
Chromosome 12 (position 27400394)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25781382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAACCCCAACGGCATGGACCCCAAAGAGCTGGAAGACTACAAACTGG[T/C]CTGTTAAAGCTCCATGTACAATCACTTTTCTGAAATGTCCCTCTGTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2641
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026657 Nonsense 371 542 8 13
ENSDART00000101042 Nonsense 371 542 8 13
ENSDART00000145078   None 410 None 12
Genomic Location (Zv9):
Chromosome 12 (position 27400582)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25781570
KASP Assay ID:
554-2842.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTCTGGAAGCTCAGTGTGATATTCTCATCCCTGCAGCTGGAGAGAAA[C/T]AGCTGACCAGGAAAAAKKCACACAATATCAAAGCTAAGGTCTGACAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link