gale

Ensembl ID:
ENSDARG00000002401
ZFIN ID:
ZDB-GENE-060421-6479
Description:
UDP-glucose 4-epimerase [Source:RefSeq peptide;Acc:NP_001035389]
Human Orthologue:
GALE
Human Description:
UDP-galactose-4-epimerase [Source:HGNC Symbol;Acc:4116]
Mouse Orthologue:
Gale
Mouse Description:
galactose-4-epimerase, UDP Gene [Source:MGI Symbol;Acc:MGI:1921496]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13754 Essential Splice Site Available for shipment Available now
sa17133 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005727 Essential Splice Site 176 349 6 11
ENSDART00000135569 Essential Splice Site 177 350 6 11
ENSDART00000136142 None None 144 None 6
Genomic Location:
Chromosome 17 (position 24713175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACATTAATCAAWTTGTGTAAAGAGTGTTTGMCTGWYAATATGTTCTGC[A/T]GGACTGGAATGCTGTRCTGCTCAGGTACTTCAATCCCATTGGTGCYCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005727 Nonsense 336 349 11 11
ENSDART00000135569 Nonsense 337 350 11 11
ENSDART00000136142 None None 144 6 6
Genomic Location:
Chromosome 17 (position 24708832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATCCGACTGTTTCATCTCATCACAYAGGTGAGGATCTGTGGCGCTGK[C/T]AATCCCAGAATCCCACAGGATTCAGTAATGGAACACTACCTTGAAGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fzxvvqz0