nap1l1

Ensembl ID:
ENSDARG00000002400
ZFIN ID:
ZDB-GENE-030516-2
Description:
nucleosome assembly protein 1-like 1 [Source:RefSeq peptide;Acc:NP_958475]
Human Orthologues:
NAP1L1, NAP1L2, NAP1L3, NAP1L5, NAP1L6
Human Descriptions:
nucleosome assembly protein 1-like 1 [Source:HGNC Symbol;Acc:7637]
nucleosome assembly protein 1-like 2 [Source:HGNC Symbol;Acc:7638]
nucleosome assembly protein 1-like 3 [Source:HGNC Symbol;Acc:7639]
nucleosome assembly protein 1-like 5 [Source:HGNC Symbol;Acc:19968]
nucleosome assembly protein 1-like 6 [Source:HGNC Symbol;Acc:31706]
Mouse Orthologues:
Nap1l1, Nap1l2, Nap1l3, Nap1l5
Mouse Descriptions:
nucleosome assembly protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1855693]
nucleosome assembly protein 1-like 2 Gene [Source:MGI Symbol;Acc:MGI:106654]
nucleosome assembly protein 1-like 3 Gene [Source:MGI Symbol;Acc:MGI:1859565]
nucleosome assembly protein 1-like 5 Gene [Source:MGI Symbol;Acc:MGI:1923555]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15185 Nonsense Available for shipment Available now
sa40202 Nonsense Mutation detected in F1 DNA During 2017
sa33358 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011882 Nonsense 76 385 5 15
Genomic Location (Zv9):
Chromosome 4 (position 2231114)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1486655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTGGTGAAAAGACGTGTTAATGCACTTAAGAACCTCCAGGTCAAATG[T/A]GCCCATATYGAAGCTAAATTCTATGAAGAAGTCCACGAGCTGGAGCGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011882 Nonsense 84 385 5 15
Genomic Location (Zv9):
Chromosome 4 (position 2231090)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1486631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTTAAGAACCTCCAGGTCAAATGTGCCCATATCGAAGCTAAATTCTA[T/A]GAAGAAGTCCACGAGCTGGAGCGAAAATATGCAGCTCTTTATCAGCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011882 Essential Splice Site 135 385 6 15
Genomic Location (Zv9):
Chromosome 4 (position 2229086)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1484627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGAGTGGAAGCAGGATGAGGAGGAAGAGCTGACAGTAAGTAAGCAG[G/A]TACAGGTGATCCATACCTGCATGCTTTACAAACACTGCCACCGCCTTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link