cry-dash

Ensembl ID:
ENSDARG00000002396
ZFIN ID:
ZDB-GENE-040617-2
Description:
Cryptochrome DASH [Source:UniProtKB/Swiss-Prot;Acc:Q4KML2]
Human Orthologues:
CRY1, CRY2
Human Descriptions:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
cryptochrome 2 (photolyase-like) [Source:HGNC Symbol;Acc:2385]
Mouse Orthologues:
Cry1, Cry2
Mouse Descriptions:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]
cryptochrome 2 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24478 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035992 Nonsense 461 520 13 14
ENSDART00000139329 Nonsense 462 521 13 14
Genomic Location:
Chromosome 24 (position 20804650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGTTCACACACCATGGACCCTCAGCAACTCAGCGCTGTCACACGCA[C/T]AGGTCTCACTCAACCAAACATACCCTTGTCCCATCATCACCGCACCCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cv42b2th