atm

Ensembl ID:
ENSDARG00000002385
ZFIN IDs:
ZDB-GENE-040809-1, ZDB-GENE-040809-1
Description:
Ataxia telangiectasia mutated [Source:UniProtKB/TrEMBL;Acc:Q59IS5]
Human Orthologue:
ATM
Human Description:
ataxia telangiectasia mutated [Source:HGNC Symbol;Acc:795]
Mouse Orthologue:
Atm
Mouse Description:
ataxia telangiectasia mutated homolog (human) Gene [Source:MGI Symbol;Acc:MGI:107202]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14977 Essential Splice Site Available for shipment Available now
sa24975 Nonsense Mutation detected in F1 DNA During 2014
sa15974 Nonsense Available for shipment Available now
sa6364 Nonsense Mutation detected in F1 DNA During 2014
sa22587 Essential Splice Site Available for shipment Available now
sa17959 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002922 Essential Splice Site 195 2452 None 51
ENSDART00000086173 Essential Splice Site 194 2458 None 54
Genomic Location:
Chromosome 15 (position 6498174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCCTGTGAGGTTGCTGAATGACCTGTGTGACATGTCCAAACAATTGG[T/G]AAGATTTATTAGCATTCCATAATTATAGCSAGYTAGTGGGAATTTYATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002922 Nonsense 1357 2452 27 51
ENSDART00000086173 Nonsense 1363 2458 30 54
Genomic Location:
Chromosome 15 (position 6455994)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTCTGAGATCTACGTCGACAAGATCAGATCCAACATGGAGCAGAAT[C/T]GAAGGTACAGTACTGGCGGAATACATAAATGAATGCATTCAAAAGCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002922 Nonsense 1661 2452 34 51
ENSDART00000086173 Nonsense 1667 2458 37 54
Genomic Location:
Chromosome 15 (position 6442959)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTCACCTGATGGAGCTGTGCAGACTGGCTCRTTCTGCAGGAAACACA[C/T]AGGTGAGTCCATGGCTGCAWCCGAAATCACCTACYACTCARTAGGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002922 Nonsense 1784 2452 37 51
ENSDART00000086173 Nonsense 1790 2458 40 54
Genomic Location:
Chromosome 15 (position 6433600)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGGTTTAAAATCAAAACTACAGAGCCAGAAAACCCAGGCCTACTTTT[C/A]GCTGGCCCGTTTTTCTGACGCACAGTACCAGGGCATCGAAAACTACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002922 Essential Splice Site 2256 2452 46 51
ENSDART00000086173 Essential Splice Site 2262 2458 49 54
Genomic Location:
Chromosome 15 (position 6410316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGAGACGGCTAGCTTACACTCGTAGCGTGGCCACCTCTTCTATTGG[T/C]ACACATACACACTATCATAAACCAAGCTGAGCATAAACTACTCTCACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002922 Essential Splice Site 2344 2452 49 51
ENSDART00000086173 Essential Splice Site 2350 2458 52 54
Genomic Location:
Chromosome 15 (position 6405693)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGAAGTTATGAGGAGTTCTCAGGAAGCCCTTTTGACCATTGTGGAGG[T/C]AAACGGATCATTTCATTAGGTCTYGYAACTACAGGTAGGATKGTTCACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g39mdz9r