lass5

Ensembl ID:
ENSDARG00000002365
ZFIN ID:
ZDB-GENE-030131-1740
Description:
LAG1 longevity assurance homolog 5 [Source:RefSeq peptide;Acc:NP_955922]
Human Orthologue:
LASS5
Human Description:
LAG1 homolog, ceramide synthase 5 [Source:HGNC Symbol;Acc:23749]
Mouse Orthologue:
Lass5
Mouse Description:
LAG1 homolog, ceramide synthase 5 Gene [Source:MGI Symbol;Acc:MGI:1919199]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43761 Nonsense Mutation detected in F1 DNA During 2016
sa24066 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011076 Nonsense 172 387 5 10
Genomic Location (Zv9):
Chromosome 22 (position 5695201)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5741268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTCTCCGTGGATGTGGGATACGAGACAGTGCTGGTACAACTACCCCTA[T/A]CAGGTAATGCTTGAATGATTTTTAATGCAGGTTCAGATTAATCCCCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011076 Nonsense 183 387 6 10
Genomic Location (Zv9):
Chromosome 22 (position 5694709)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5740776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTTTGTGTGTTGTAGGTGCTGACCTCAGGCCTGTATTATTATTA[T/A]GTAACAGAACTGGCCTTCTACTGGTCGCTCATGTTCTCTCAGTTCACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link