lass5

Ensembl ID:
ENSDARG00000002365
ZFIN ID:
ZDB-GENE-030131-1740
Description:
LAG1 longevity assurance homolog 5 [Source:RefSeq peptide;Acc:NP_955922]
Human Orthologue:
LASS5
Human Description:
LAG1 homolog, ceramide synthase 5 [Source:HGNC Symbol;Acc:23749]
Mouse Orthologue:
Lass5
Mouse Description:
LAG1 homolog, ceramide synthase 5 Gene [Source:MGI Symbol;Acc:MGI:1919199]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7977 Nonsense Mutation detected in F1 DNA During 2014
sa4981 Nonsense Mutation detected in F1 DNA During 2014
sa24066 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011076 Nonsense 143 387 4 10
Genomic Location:
Chromosome 22 (position 5695465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTGACAACAGCTGTGTTTTTCTCTACAGGTGGAGGTTTACATTCTA[T/A]CTGTCTATATTTACGTATGGGATGCGTTTTCTGTGGCAGGKGAGTTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011076 Nonsense 181 387 6 10
Genomic Location:
Chromosome 22 (position 5694715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGTGTGTGTNNTTGTGTGTTGTAGGTGCTGACCTCAGGCCTGTATTA[T/G]TATTATGTAACAGAACTGGCCTTCTACTGGTCGCTCATGTTCTCTCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011076 Nonsense 183 387 6 10
Genomic Location:
Chromosome 22 (position 5694709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTTTGTGTGTTGTAGGTGCTGACCTCAGGCCTGTATTATTATTA[T/A]GTAACAGAACTGGCCTTCTACTGGTCGCTCATGTTCTCTCAGTTCACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/04otshns