Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cyp11a1
- Ensembl ID:
- ENSDARG00000002347
- ZFIN ID:
- ZDB-GENE-010306-1
- Description:
- cytochrome P450, subfamily XIA, polypeptide 1 [Source:RefSeq peptide;Acc:NP_694485]
- Human Orthologue:
- CYP11A1
- Human Description:
- cytochrome P450, family 11, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2590]
- Mouse Orthologue:
- Cyp11a1
- Mouse Description:
- cytochrome P450, family 11, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88582]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa38075 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38075
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000024866 | Nonsense | 186 | 509 | 5 | 11 |
| ENSDART00000073566 | Nonsense | 186 | 509 | 3 | 10 |
| ENSDART00000132839 | Nonsense | 186 | 245 | 5 | 6 |
| ENSDART00000141899 | Nonsense | 186 | 266 | 5 | 6 |
| ENSDART00000142044 | Nonsense | 186 | 236 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 25 (position 23048721)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 22227834 GRCz11 25 22325382 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGACTTTGTGGCTCGTGTCAACAAACAGATTGAGAGGAGTGGGCAAAAA[C/T]AGTGGACCACAGATCTGACCCATGACCTCTTCAAGTTTTCACTGGAATGT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
