cyp11a1

Ensembl ID:
ENSDARG00000002347
ZFIN ID:
ZDB-GENE-010306-1
Description:
cytochrome P450, subfamily XIA, polypeptide 1 [Source:RefSeq peptide;Acc:NP_694485]
Human Orthologue:
CYP11A1
Human Description:
cytochrome P450, family 11, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2590]
Mouse Orthologue:
Cyp11a1
Mouse Description:
cytochrome P450, family 11, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88582]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38075 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024866 Nonsense 186 509 5 11
ENSDART00000073566 Nonsense 186 509 3 10
ENSDART00000132839 Nonsense 186 245 5 6
ENSDART00000141899 Nonsense 186 266 5 6
ENSDART00000142044 Nonsense 186 236 4 5
Genomic Location (Zv9):
Chromosome 25 (position 23048721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22227834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACTTTGTGGCTCGTGTCAACAAACAGATTGAGAGGAGTGGGCAAAAA[C/T]AGTGGACCACAGATCTGACCCATGACCTCTTCAAGTTTTCACTGGAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link