ccdc101

Ensembl ID:
ENSDARG00000002339
ZFIN ID:
ZDB-GENE-041010-62
Description:
SAGA-associated factor 29 homolog [Source:RefSeq peptide;Acc:NP_001005986]
Human Orthologues:
AC133555.2, CCDC101
Human Descriptions:
coiled-coil domain containing 101 pseudogene (LOC388242), non-coding RNA [Source:RefSeq DNA;Acc:NR_0
coiled-coil domain containing 101 [Source:HGNC Symbol;Acc:25156]
Mouse Orthologue:
Ccdc101
Mouse Description:
coiled-coil domain containing 101 Gene [Source:MGI Symbol;Acc:MGI:1922815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26015 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007726 Essential Splice Site 255 293 9 10
ENSDART00000124063   None 177 None 7
ENSDART00000144369   None 213 None 8
Genomic Location (Zv9):
Chromosome 3 (position 15095129)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15340735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACCACCTGCTTTTACAGAGCTCTGATCCACACACCACCGCATCGGG[T/C]GAGCAAAACTAAACTCAAACTAGAGAAAATGTTCCTATTTCACATACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link